Mendel's Dwarf
Simon Mawer
I didn’t return home that evening. Home was a cheerless, empty basement flat purchased with the money that Uncle Harry left, and furnished with some of those pieces of furniture my father had made for me—diminutive chairs, a low table, reduced wardrobes: a veritable fairytale dwarf’s cave it was. But I couldn’t face the place that evening, so I drove instead to the laboratories, where the night staff were on duty and one or two colleagues would be at work late. I had an alibi—a culture incubating, or something similar—and I had things I could do, trivial tasks that would bring comfort through distraction. Work is a palliative, you see.
“You all right, Ben?” I was asked.
I was fine. I turned on the computer and logged on to Johns Hopkins to look through some recent papers. I was fine. I read about fragile-X syndrome and about familial colonic polyposis and about mismatch repair. The telephone rang twenty minutes after I’d got there, the direct line to my lab. It was Jean. Her small gray voice fluttered in my ear. “I thought I’d find you there. I rang to apologize.”
“You’ve already done that.”
“Actually, I wanted to see if you were all right.”
“I’m all right. Just wonderful. How did you know I would be here?”
“I sort of guessed. I sort of knew. I thought maybe that’s where you’d go. Am I forgiven?”
“For you, there’s nothing to forgive.”
“Those bloody people have gone. They went soon after you left. Hardly surprising, I suppose. Hugo has gone to bed.”
“And you haven’t?”
“I stayed to do the washing up. Hugo’s asleep, and I thought I’d give you a call.”
The incubators hummed. Someone opened and closed the doors to the sterile room. All around me was the timeless, chalky light of the labs. Above the shelves of gleaming bottles, the windows were as black as ebony. “Are you ready for bed?”
“I’m just going. Ben, I just rang to say how sorry I was—”
I could imagine her, of course. My imagination in such matters is fine-tuned. I could picture her in the narrow hallway, holding that ridiculous imitation Edwardian telephone receiver to her ear and standing awkwardly, with one foot perched on the other. I could imagine her toes, distorted by a lifetime wearing narrow shoes. I could imagine her hair freshly brushed out. I could see the simple cotton nightdress and the pallid legs. There would be a faint trace of hair on her shin where the razor had not quite done its work. I am an expert on legs. I live at the level of legs. Bereft of their armor of nylon tights, her legs would have an awkward vulnerability.
“I think you’d better finish what you’re doing and go home,” she said. “Drive carefully.”
Oh, poor, sad dwarf, hidden in your cave, your trident hands (fine, roguish, neptunian adjective) working away with method and expertise at solitary delights, your mind nosing into the declivities of bodies both imagined and imaged there on the bedspread in full and iridescent color—“Glorious Gloria is Game for any Guy,” so the captain claims, no doubt mendaciously. The imagination works, the fantasies blossom. One tries to keep things pent up for a while, tries to prolong the meager ecstasy, but the inexorable tide is rising. Gloria becomes Olga Codon, becomes the glimpse of Mrs. Downstream’s knickers, becomes a distant memory of Dinah, a vivid memory of Eve, becomes Jean … Sensation wells up. The surge comes suddenly and anti-climactically, flushing all fantasies away like flotsam from a storm drain, to deposit them, a glutinous liquid, onto the strategically placed towel.
The enemy is self-pity. You guard against self-pity, build bastions of cynicism, dig ditches of irony and sarcasm; but sometimes, just sometimes, the barriers are breached.
Sleep of a kind. The sleep of the damned. To dream of Jean.
I dream a great deal. What would the Blessed Sigmund Fraud have made of that? I dream of a railway line. Long ago the Blessed Sigmund decreed that railways signify death, so according to him, I dream of death.
My railway line runs from nowhere to nowhere. The empty tracks stretch away into the distance while the train sweeps along, drumming over the rails. Clackety-clack, clackety-clack the wheels go, and the track is everything, the sum total of perception, the only landscape. Sometimes, rarely, there is a disturbance: a signal flashes past, followed by a signal box with a name written on it, a curious and childlike name to go with the childishness of the dream—TATA—and after it comes the sudden relief of a station, the concrete platform rising out of the verge like a wave, the line of forlorn people standing in the rain, a long and bewildering nameboard like an anagram in a crossword, and then there is the open line again, the monotonous thrumming of the wheels, the flashing sleepers, thousands and thousands of them, all without meaning or sense or significance.
The blessed Sigmund is wrong—my dreams are not about death, they are about life: the vacuity of life.
“What do you do?” Miss Piercey asks over lunch in The Pig and Poke. You can hear the italics in her speech. “I want to understand what you do.”
“At least you’re not like your husband. He already seems to know what I do better than I.”
She ignores the taunt. “Tell me. Explain.”
It is very simple, that is the important fact to grasp. Nuclear physicists, astronomers, chemists—the quintessential scientists, the inheritors of alchemy—have always lived in a world apart, a world bound by the impenetrable barriers of complex equations, of techniques and ideas beyond the feeble grasp of you and me. Not we molecular geneticists. Oh yes, there is a bit of trickery. You need a certain aptitude for puzzles, for riddles, for brainteasers—but little more. If you have a gift for anagrams or a fluency with crosswords, or if you can worry away at the kind of conundrum you find inside the back cover of a magazine, then you could do it too:
Suzie has a piece of string one yard long. Bill cuts it into five pieces of different length. Then Jim cuts Bill’s fragments into a further six pieces. Suzie now wants to reconstruct her original piece of string. She knows that Bill’s cuts were …
The molecular geneticists among you will have smiled at the mere mention of the word fragment. It has semantic power. But others will have merely shrugged, like Miss Piercey does, “It can’t be just a kind of game,” she protests.
Oh, but it is. And the techniques are simple, too. About as difficult as haute-cuisine cookery, say: occasionally tricky, but nothing that Miss Piercey couldn’t turn her hand to, if need be. Furthermore, in this particular instance the dish and the cook are one and the same thing, which brings a pleasant tartness to the palate.
Meet My Maker, the Mad Molecule
The molecule in question—the celebrated double helix, the acronymic DNA—is by now known to all in one way or another. Even high-court judges need to have some idea of it, even readers of the popular press recognize it, if only as a way of catching out a rapist by analyzing his sperm. When I speak of this, Miss Piercey makes a face which signifies disgust and disapproval.
“But it’s there,” I assure her, “whether you like it or not, there in the nuclei of all of your cells.”
“The sperm?”
“The DNA. The molecules are there in every cell, carefully folded away like linen in a bottom drawer. Every function of every cell depends on it.”
“You mean”—a frown puckers her forehead—“it’s there at this moment, wriggling round inside me?” She shifts on her seat, as though things are moving beneath her skirt. And there is that sound as she moves: the faint, intimate whisper of nylon against nylon.
“Every second.” I draw a diagram on a paper napkin to explain. I’m afraid it’s my didactic manner once more, but it brings results; she leans forward to look. A lock of her hair brushes my face, and her scent envelops me, a faint breath of musk. Are such messages intentional? Does she know what she is doing? As I sketch my diagram, I am constrained to rearrange matters within my trousers. “The molecule has the shape of a twisted ladder,” I tell her. “A Jacob’s ladder, if you like, but a Jacob’s ladder that goes both ways; w
e may use it to attempt to ascend to the throne of God … but we can also use it to descend into the pit. So beware.”
“And which way are you planning to go, Dr. Lambert?” Jean asks as she flips the errant lock of hair behind her ear.
The Message
The message of the genes lies along one of the strands of the ladder, and it is written in an alphabet of only four letters—A, C, G, and T. That is the alphabet of life. The letters are really chemical groups called bases, and the bases of one strand grasp the bases of the other strand to form the rungs of the ladder. They bond thus: an “A” on one strand always bonds with a “T” on the other; a “C” always bonds with a “G.” The result of these rules is that the sequence along one strand is exactly complemented by the sequence along the other. The sequence of letters, say:
GGCATCCTCAGCTACGGGGTGGGCTTCTTCCTG
is exactly complemented by the equivalent sequence on the other, complementary strand:
CCGTAGGAGTCGATGCCCCACCCGAAGAAGGAC
I turn the paper napkin for her to look. “Strings of these paired letters go on and on and on into the distance, like the sleepers of a railway. One side is the message, the other the anti-message. Sense and anti-sense, like a looking glass. Just over a thousand of such paired bases makes up an average gene, but the whole molecule of DNA is longer, far, far longer than that.” I talk the language of megabases—millions of bases—and Jean looks bewildered: “An average human chromosome,” I tell her, “contains a single DNA molecule of eighty million base pairs. That is long, not just in cellular terms but in real terms: It is some centimeters long. In each human cell, adding together the forty-six chromosomes, there is a total of about two meters of DNA.”
She shakes her head. “But what’s it all mean? It says ‘cat’ there.” She points with one slender and talon-tipped finger to the scrawl on the napkin. “And ‘tag.’ It looks like gibberish to me.”
“But it’s not gibberish to your cells.” In the background, Eric roars with laughter over some new joke a customer has just told him. Nearby, the pinball machine shrieks and whistles. And I wonder about Jean’s DNA, about her cells, about the very fabric of her body, while she sits there in front of me with her legs artfully crossed so that all I can see above her knees is a triangular tunnel of shadow.
She straightens up to look at me. “So what does this DNA stuff say?”
“It holds the instructions to make you: a phenotypically normal woman, brown haired, slim, good-looking, nervous, self-deprecating, confused about your husband …”
A blush has suffused her cheeks. “All that? Come on.”
“Or, with one single, hideous spelling mistake in the whole instruction manual, me.”
She is still. The nervous shifting has gone, the blush has paled. Her eyes, those strange, mismatched eyes determined by some error no bigger than the one within me, glisten. “Oh, Ben,” she whispers.
But of course I ignore her little show of emotion, and ignore too the slender hand that reaches across the table to take my stubby one. This is my subject, this is what I do, this is what, for want of a better word, I believe. This is where Ben the scientist takes over from Ben the dwarf. “You must understand that the DNA isn’t carrying the message: The message is an integral part of the molecule. The message is the molecule. And just so, there isn’t a fundamental you that stands outside all this and watches it from some exalted viewpoint, like a reader looking at a book. It’s much stranger than that. You watch it with the machinery that it has created. You understand it—or fail to—with the machinery that it has created. That’s the point. The medium really is the message.”
“You keep saying it’s a message, but if it’s a message, how do you read it? What does it say?”
I shrug. “It says proteins. That is all, and that is everything. The message decides the proteins your cells can make, and the proteins determine everything else. There are lots of different proteins in your cells because there are lots of different things to do, so there are lots of different genes—maybe one hundred thousand in the entire human genome. We’ve not yet finished counting, but it won’t take long.”
“And if the message means something,” Jean asks, “who wrote it?”
The Genetic Code
It is not a code. A code is created in order to deceive. No one was trying to hide anything, no God was playing games, creating a conundrum, proposing a puzzle, writing a rebus. The so-called genetic code evolved simply to work. It is not a code: it is a language, and a disturbingly simple one. Each word in the language consists of just three letters, any three out of the four, A, C, G, and T. All possible combinations mean something, which means that the language has just sixty-four words. English has twenty-six letters and a vocabulary of some five hundred thousand words, but the language of the genes, which is sufficient to produce systems that can speak all the languages in the world and understand everything that has ever been understood, this genetic language has but sixty-four words. Furthermore, many of the words are exact synonyms of others—there may be sixty-four different words, but together they have a mere twenty-one different meanings.1
There is another simplicity in the system. With almost no exceptions,2 the language of the genes is universal. The same language is used by your own cells as by the virus that is giving you a head cold, or the bacterium that is giving you a sore throat. The genes that make up the oak tree outside your window and the fly buzzing against the window pane all speak the same language. All words mean the same thing to all animals and all plants. There has been no Tower of Babel in the history of cellular evolution.
“It seems confusing enough to me,” Jean says. And then she looks at me with a curious directness. That is one of the things I find remarkable about her, her childlike directness. “So where do you fit into all this?” she asks. “What exactly does the great Benedict Lambert do?”
What, indeed? Victim and victor, I probe into the most intimate details of the human genome. Where Uncle Gregor Mendel merely discovered the manner in which inherited factors are passed on from father to daughter or mother to son, I finger his factors and pull them gently to pieces, like a little boy pulling the wings and legs from a fly. I mime the action and evoke a delicious shiver from Jean Piercey. “Or a young girl pulling the petals from a flower. He loves me, he loves me not, he loves me, he loves me not.”
“And the dwarfs?” Her gaze is steady and direct. She possesses a strange courage.
“Ah, yes, the dwarfs …”
I look for meaning among the misprints of life, and so I have become a kind of impresario, a Billy Smart of genetics, a Barnum and Bailey of the genome, an heir to Grandfather Godley and his freak show.
I collect dwarfs.
“What’s all this about, then?” one of them asks loudly to the waiting room of the clinic. The room is decked out with potted plants—aspidistra, ficus—and has bright and hopeful pictures on the walls. The man looks around the place suspiciously. He is there with his family. The wife smiles in a motherly kind of way and clips the ear of the child, a blithe and oblivious three-year-old who is trying to tear a copy of Cosmopolitan to pieces. They have come from just down the road, from Olympia, where the posters are currently showing raging lions and clowns with red noses and crossed eyes and bowler hats with flowers coming out of the top. Chipperfield’s Circus is in town.
“Who is this geezer who wants us?” The father says that. Geezer. “Who is this geezer, then?”
A nurse smiles patiently and points out where to fill in the name and date of birth of each member of the family. “Doctor Lambert will then ask you a few questions, if you don’t mind. We do appreciate your offering to help like this.”
“Help? Help who?” He appeals to me as though to an ally. “Who is this geezer Lambert? Any idea?”
“Doctor Lambert will explain everything,” the nurse repeats.
The man looks suspicious. “I don’t want anyone trying to cure us. Where’d we be then, eh? Out on the streets without a jo
b.”
“Don’t worry about that,” the nurse replies brightly. “There’s no cure. Now if you just go with the doctor …”
Only then does comprehension dawn. He stares at me. “Oh, you’re ’im, are you? I fought you was one of us. Blimey, you could knock me down with a feather. In fact that’s exactly what they do, most of the time—knock me down with a feather, I mean.” He roars with laughter, his face knotting up and the sound rattling the windowpanes of the interview room. He is used to laughing to a large audience, making it clear when things are meant to be funny—which is most of the time, presumably. “You from circus folk, too?” he asks.
“No, I’m not.”
The man nods his overlarge head in sympathy. “Just came out of the blue, did you? Luck of the draw, eh? That happens, don’t it? I’m Tom Thumb. Well, obviously. You always end up as Tom Thumb. Typecasting. Pleased to meet you.” He holds out a stubby hand for me to shake with its twin, my own stubby hand. It is like looking in a mirror, that’s the curious thing. Whenever you meet up with another one, it is like looking in a mirror, as though the mutation has overcome all the quirks of inheritable variation and produced a kind of clone. And yet all we share is a jot, a mere tittle, one trivial spelling mistake in the whole instruction book.













