Last Chance--A Novel, Page 2
Gregg Hurwitz
Another life squirming inside each dead-to-the-world kid. Feathering the skin with stretch marks. Pulsing.
Almost ready to hatch.
More Drones patrolled the aisles between the slabs, tending their depraved crop. That’s what it all resembled—some kind of gruesome farm.
And then the Drones carrying me turned, my view disappearing. For a moment I could see only tree trunks. I was carried over a rise in the forest floor, my shoulders jolting. My hip brushed against bark. A muscle cramped at the base of my neck. Pine needles streaked overhead.
At last we broke through the tree line, stepping out into the open.
Countless Drone helmets rose in unison to note my arrival. They swiveled toward me, every last one of them, moving as a single piece.
I hadn’t thought it would be possible for dark-tinted face masks to convey rage.
I swung there on the branch, blinking against the sudden light, completely exposed before the waiting phalanx of Drones.
A terrible insectoid screeching filled the air. Though none of the Drones moved, mist shot out of valves around the necks of their armor, dissipating in the air. The cries echoed off the walls of the valley, stirring birds from the treetops.
Panic overwhelmed me, a wet blackness that filled my lungs. I struggled against my restraints, shouting and trying to kick myself free.
We started the final descent.
ENTRY 3
For a moment there was only blind panic. Pain brought me out of it. I realized that all my bucking and squirming just made the restraints dig deeper into my wrists and ankles. Sunbursts dotted my vision; I was light-headed from hanging upside down for so long. Freaking out certainly wasn’t helping things.
I tried to calm myself. What would Patrick do? I pictured him with his half squint, staring out from beneath the brim of his black Stetson. He’d take whatever was coming. Spit in the mask of the nearest Drone. Go down like a man.
I closed my eyes. Drew in a shaky breath. Released a shakier one.
Good-bye, big brother. You taught me well. I’ll try not to embarrass you now.
I thought about Alex wearing her fiercest scowl, the one she used to reserve for the ice-hockey rink. I’d seen her shoot her own father after he’d transformed. I’d seen her almost take the head off a Host with her hockey stick. I couldn’t imagine her bowing down to anyone.
I took another breath, this one steadier.
Good-bye, Alex. You were part of what kept me going. If I couldn’t be with you, at least I could be near you. Because of you I always wanted to be more than I am. I’ll try to be that now.
My exhale, smooth as a saddle horn.
I hope you guys were together at the end.
I opened my eyes.
See you soon.
For the first time, I let my muscles relax. I lolled from the branch, swaying hypnotically. We crossed the parking lot, heading for the cannery and the foundation beyond. The Drones that were gathered around their dead Queen grew closer with every step. Several paces beyond at the corner of the foundation, a cracked-open meteor the size of a Volkswagen rested on a nest of shattered concrete.
As I was carried across the front of the factory, some of the kids cried out from their cages. A girl sobbed hoarsely. Tiny fists pounded bars. I heard my name called—a survivor from Creek’s Cause?—but couldn’t turn my head far enough to see who it was.
We passed the cannery, nearing the foundation. A stench wafted over on the breeze. The putrid smell, I realized, came from the floating Husks—more precisely, from the Hatchlings growing inside them.
My captors paraded me before the other Drones, showing off their prize. I hung there, observed by all those face masks, and braced myself for whatever was coming.
I pictured the dying Rebel hiding with me in the dark core of the massive tree. The guttering glow of his mask. His hand resting on mine. No matter what, they must never find out who you are. Do not let them take you. We will contact you when we can and tell you of your mission. Until then you have one job: Stay alive.
One job. And I’d failed.
The dead Queen’s armor lay beneath me. The jagged hole in the helmet looked like a mouth. There was only blackness beneath, an empty suit. The armor still held her form, taller and more slender than that of the Drones. One of her arms tapered into a stinger that she’d plunged into the bellies of countless kids and teenagers. I shuddered off the memory. Then I stared up at the rows of face masks.
“Well,” I said. “Let’s get this over with.”
They gazed back blankly. A faint breeze carried the stink of the Hatchlings. I could hear them inside the Husks, straining the flesh, the wet sucking noises making my stomach roil.
My peripheral vision caught a movement. Mr. Tomasi, lumbering over. His work slacks were missing one leg from the knee down, and bone glittered through a wound in his thigh. He wielded a box cutter.
Extending the slender blade, he crouched, a black silhouette except for the two holes where the light shone through. His shadow darkened my face.
I confess, I might have closed my eyes.
I heard a slicing sound, and then the foundation rushed up and hit me.
He’d cut my restraints.
Already he was shuffling away.
I went to stand up, but then a boot came down on my neck, pinning me to the concrete. The tread ground into the hinge of my jaw so heavily that I thought the bone might snap.
A Drone reached down, grabbed my arms, and ripped me to my feet. His gloves weren’t really gloves, just an extension of the seamless suit. They felt as cold and hard as metal, but somehow they were still flexible. They dug into my biceps now and I thought they might break right through the skin.
I glared into the impenetrable mask. Glared at the life-form beneath, which—from what little I’d gleaned—was composed of gas swirling inside the airtight suit.
The Drone spun me around so I faced the sea of floating Husks. The smell hit me hard, and I gagged. Crushing me in his grip, the Drone marched me across to where the cracked-open meteor had landed. I say “landed” instead of “crashed” because the inside was a perfect globe of a cockpit. The walls were rimmed with transparent screens that seemed made of the same organic matter that formed the eye membranes of the Hosts.
Bluish lights flickered across the screens, data scrolling quicker than I could register. Thousands of subscreens tiled the display, speeding through what looked like live footage. Each one flipped every few seconds, showing new scene after new scene. A few lodged in my mind: Towering high-rises on some desolate, trash-blown city street. A Third World slum, sheets flapping from ropes. A freeway on-ramp crowded with empty cars, some of them smashed into a center divide.
Were these the feeds from the Hosts mapping out the standing infrastructure of our planet?
A similar bank of subscreens mirrored the first, digesting all that footage. Every line, every angle, the composition of every object—each was delineated by some sort of digital outline, charted like Google Maps.
The computing data was awesome. Everything connected to everyone watching everything. How could we possibly stand a chance against it? That’s how we’d die, all of us. Tumbling into the void of omniscience. I felt like a speck of dust free-falling inside the brain of God.
Sweat ran down from my hairline, stinging my eyes. I reminded myself to breathe.
Shouts rang out behind me, and I looked over my shoulder. Through the rolled-back factory doors, I had a partial view of the kids in the crates. Which meant they had a view of me. The insides of the crates were lost to shadow; all I could make out were skinny arms thrust through the bars, waving, grasping, reaching for me. The whole wall looked like a multilimbed monster.
The Drone clenched my neck and turned my head back to the split-open meteor. I faced the curved interior straight on. Something in the cockpit must have registered me there, because all at once the screens went dark.
Wind froze the perspiration across my shoulders
. My stomach leapt. I peered into the halved globe and waited and then waited some more.
A light lasered from the center screen so suddenly that I cried out. It shot a few feet above my head. Heat radiated down on me. I looked up to see where the light had expanded to form a bluish sheet. Flat and contained, it hovered there, projected into thin air. It was a perfect square, just wider than my shoulders. A single ray of light tethered it to the cockpit, a string holding a kite in place.
The sheet began to lower.
The heat grew more intense, making my scalp prickle.
I went to run, but two Drones held me in place.
My chest heaved with panic breaths; I couldn’t stop it any more than I could stop the downward creep of that blue sheet.
Just before it reached me, I lowered my gaze to protect my eyes. A burning spread across my crown, and then my hair felt singed, and then—
atcgggaatccctaacgtccccaatttaaggggggaactctacggactaccta
My brain emerged, gasping for air almost literally. The light scanned through my insides like a heated metal plate. I felt it moving down my neck, inside my throat. My chest caught fire, and then my stomach burned. The worst was next. Sweat popped out across my forehead, rolled down my cheeks, pooled in the hollow of my neck. Thighs. Knees. Shins.
At last it was over.
The sheet zapped back inside the cockpit.
The screens seemed to power off.
The Drones released me. Jerking in a breath, I stumbled forward. The heel of my hand struck the bottom of one of the screens, and it rippled like water. As the Drones yanked me back to stand, my palm came away gooey. I wiped it on my jeans and waited to see what would happen next.
The screens ignited, showing hundreds of readings. Cells. Hair strands. Twisting ladders.
On one of the side screens, a rendering appeared, every last contour of a face and body, rotating on display. There I was—Chance Rain, in wireframe.
My insides had been mapped as thoroughly as all those street and city views.
My DNA, broken down and analyzed.
The Rebel’s voice echoed again inside my head: No matter what, they must never find out who you are.
Good luck with that.
The screens zoomed in on one of the DNA ladders. And then it pushed further into one of the chromosome rungs.
I remembered reading about genetics in Mrs. Wolfgram’s science class. She’d been a good teacher, Mrs. Wolfgram.
The last time I’d seen her, Patrick had obliterated her head with a Winchester shotgun.
On the meteor screen, my chromosome rung magnified even more, the map of me growing larger until a section of base pairs was visible.
All of the base pairs, like everything else, were depicted in blue.
Except for one.
That one was rendered in red.
And it was blinking.
I blinked right back at it.
Its edge looked jagged, like one set of teeth on a zipper.
“What the—”
My next word was drowned out by a roar overhead. I barely had time to pull my gaze north when a meteor streaked down and embedded itself in the parking lot across from the other one. The earth shook, flipping the few remaining cars onto their sides. The meteor plowed up a wake of asphalt.
It rested there, smoldering, the air around it gone wavy with heat.
Then it cracked open with a popping noise.
The jagged exterior hid the smooth orb of a cockpit inside. As the meteor hinged wide, I saw her inside, a sleek black form, slender legs drawn up to her chest.
The Queen uncoiled from the cockpit.
My guts turned to ice.
We’d risked everything to kill the last Queen, and here was another one, plopped down from the heavens to take her place. How many more were there? What had we even been thinking? The fight suddenly felt pointless. Not that I’d be around much longer to worry about it.
The Queen’s lustrous black suit held the faintest curves of a woman’s shape. She walked so gracefully that she practically glided across the ground. The closer she got, the taller she seemed.
At last she loomed over me.
“You are Chance Rain.” Her voice was digitized, feminine and yet seemingly without life. Amplitude bars flickered across her tinted face mask with each syllable. The helmet itself seemed to be translating. “You are one of the two.” She wasn’t asking; she was telling me.
I swallowed hard, managed to move my head up and down.
“Where is Patrick Rain?”
I felt my mouth start to wobble, so I bit down on my cheek. Warmth spilled through my mouth. “He’s dead.”
“That is acceptable,” she said, the amplitude bars dancing like blue fire. “You must be voided, too.”
I channeled my inner Patrick and spit in her face.
Behind me the kids cheered from their cages. Blood-laced saliva dripped down the Queen’s face mask.
She had no emotional reaction. Her head cocked, as if gauging how to respond to this display. What did getting spit on even mean to her?
Mist burst from her neck valves—a show of aggression. At this proximity the shriek was earsplitting. She reared up. Her stinger arm twisted behind her, a tentacle drawing back to strike. Small sensory bumps squirmed along its entire length, but I wasn’t watching them.
I was watching the tip, tapered to a vicious point.
It flicked once. The stinger firmed, swelling with what looked like muscle.
The Drones held me in place. My feet were numb. My body had turned to soup. I could feel my face, contorted into a mask of my own.
I took my last breath.
That’s when we heard it.
A distant rumble, followed by a crashing sound and the roar of machinery. The Queen wheeled around to look. Way up at the brink of the valley, the cab of a semitrailer truck burst into view, blazing straight through a patch of young pine trees. On either side of the semi, protruding like tusks, were undercutters. The giant chain saws, usually attached to a backhoe, were designed for cutting rock—or clearing forest. Which they were doing right now, carving a path straight through the pine trees. The Drones had used the detached undercutters yesterday to knock down some of the trees in their search for me. It took a moment for my brain to process that they’d been rigged onto the semi.
The massive truck barreled down the slope toward us, crushing everything in its path, snapping trunks like beanstalks, bouncing over the timber, its ten mighty wheels roaring for traction.
The sun glinted off the windshield, turning it into a rectangle of fire. As the truck pulverized the last row of trees and smashed onto level ground, it skidded sideways. The glare lifted from the windshield.
Through the dusty pane, I made out a shadow behind the wheel. A male form.
Wearing a cowboy hat.
ENTRY 4
“Holy crap,” I said.
But no one was listening to me.
I took advantage by wrenching free of the Drones and throwing myself aside.
Facing the truck, the Queen puffed up to her full height. The Drones spread wide across the foundation. A cluster of them broke loose and charged.
The semi truck bounced violently over the curb, hurtled onto the parking lot, and demolished the Queen’s meteor. Rock fragments and blue-tinged goo exploded across the hood.
The tires screeched as the truck rocketed into a too-sharp turn. Those vicious undercutter tusks swung toward the advancing Drones. The driver’s window was rolled down, and I caught a perfect glimpse through.
It was Patrick all right.
My throat clutched. My mouth guppied, looking for air. For a moment I thought maybe the Queen had skewered me with her stinger and this was some weird afterlife dream.
The vanguard of Drones flew toward the semi. The semi raced to meet them.
At the last minute, Patrick raked the wheel to the side. One of the giant chain-saw blades swept right through the Drones’ legs. Amputated armor spun, suddenly air
borne. Black mist exploded out of the leg holes with enough force to propel the suits off the ground. Some shot a few feet off the asphalt; some skipped across the parking lot; others spun in dying circles on the ground. In each suit the pressure of the expelled smoke lessened until nothing was left but the deflated armor. The Drones had been bled from their suits, their life matter disintegrating into the air.
The second undercutter whisked around to meet the next line of Drones. A few ducked and were severed at the midsection. Others tried to leap over the undercutter and had their boots cleanly removed. One Drone almost got away, catching only a nick in his heel. Any penetration, no matter how small, was enough. Black gas geysered from the wound with a teakettle scream of expelled air.
The semi 180’ed, lifted up onto its side wheels, threatening to tip over. When the driver’s side swept past, I swore I saw Patrick’s black Stetson dip as he gave me a little nod. The weighty back end spun toward me, pushing a wall of air before it, blowing my hair flat.
In front of me, the Queen reared up, stinger curled menacingly behind her. Gas shot through not just her neck valves but through a line of valves along her sides, too, framing her in fearsome spouts of black smoke.
The truck swept by, hammering into her, wiping her from view. Empty pieces of her armor rained down on the foundation. I stared with disbelief at the rear of the truck.
Through the dissipating smoke, a figure slowly came clear standing on the metal plate above the drive wheels. She was fastened loosely onto the back of the cab, cargo straps crisscrossing her chest like bandoliers. Her arms appeared first, glistening with sweat. Her hands gripped a shotgun. Not just any shotgun.
Patrick’s Winchester.













