Online Read Free Novel
  • Home
  • Romance & Love
  • Fantasy
  • Science Fiction
  • Mystery & Detective
  • Thrillers & Crime
  • Actions & Adventure
  • History & Fiction
  • Horror
  • Western
  • Humor

    McKean 01 The Jihad Virus

    Page 7
    Prev Next


      “That’s all speculation,” said Erwin. “But one thing is certain. Mr. Fenton’s case is an anomaly. There hasn’t been any smallpox in the Pacific Northwest since the nineteen-twenties. It’s hard to see how this case could arise spontaneously out of nature. That makes a terrorist attack at least worth keeping in mind.” She looked at me thoughtfully and added, “But don’t quote me on that.”

      “Okay…for now,” I said.

      “But, if there were a plot,” said McKean, “it is eminently sensible that the first victim would be a border agent. If someone was deliberately bringing the virus into the country, and if Fenton nearly caught him - “

      “Too bad he didn’t.” A young man in a dark blue suit had appeared at Erwin’s office door. “That would have made my job easier.”

      Kay nodded at the newcomer. “Let me introduce you fellows,” she said. “Peyton McKean and Fin Morton, this is Joseph Fuad, FBI agent.”

      We shook hands with Fuad, who appeared to be of Middle Eastern heritage, although thoroughly Americanized in dress and hairstyle. His face was clean-shaven, although his cheeks bore a five o’clock shadow despite the hour, which was not yet noon. As he exchanged hellos with us, he used standard, Midwestern English.

      Erwin explained, “Mr. Fuad is the FBI liaison to the CIA on this case, assigned by Vince Nagumo. He’s a specialist in Middle Eastern immigrant communities on both sides of the Canadian border. If there were an Islamic plot to bring smallpox into the U.S., he would have heard about it. Right, Joe?”

      “Actually, we’ve heard some rumors of that sort,” said Fuad. “But they have turned out to be idle gossip. Rumors are extremely hard to verify.”

      “Until something happens,” I said.

      He smiled reassuringly. “We haven’t turned up any real conspiracies yet, Mr. Morton.” He turned his gray eyes on McKean. “One of my duties is to keep the home office informed on your progress, Dr. McKean.”

      McKean raised an eyebrow. “No one mentioned you to me. Do you have any virology training?”

      “Not much. Just college biology at Rutgers. But I did get a solid B.”

      “That’s a start.” McKean eyed him thoughtfully. “You won’t hamstring us with a need to explain every detail, will you?”

      “No, sir. Just give me the gist of what you find out. That’s all I need.”

      McKean gave Fuad a quick rundown of Fragment B’s mysterious weight-gain, and then we left the hospital. I dropped McKean off at his lab and went back to my writing office to flesh out my notes on my scientifically prodigious new acquaintance.

      Toward the end of the afternoon, by prearrangement, I strolled over to ImCo. The guard admitted me and sent me up to McKean’s office. I arrived just as Janet was showing him the first of her DNA sequence data files. Her pretty face was lit by a glow from McKean’s computer and the excitement of discovery.

      “This DNA-sequencing run was a good, long one,” she said. “Nearly three hundred steps.” On the computer screen, the data appeared as long strings of the code letters A, T, C and G. She said, “I got into the coding region for the B7R surface antigen protein. There’s definitely something different about it.”

      “I see that.” McKean focused his dark eyes on the screen. “There is a DNA insertion, just like I suspected.”

      “Insertion?” I asked.

      McKean nodded. “Janet has found the place where the original DNA code of the virus broke open and new code was spliced in.” He pointed to a line of code on the screen and counted. “One, two, three, four, five, hmm, hmm, hmmm. Twenty-seven new code letters added.”

      “Added?” I said. “Added by whom?”

      “By nature, or by human hand. We still don’t know that.”

      I pressed him. “Can such an insertion of DNA happen naturally?”

      “Yes, it happens all the time. It’s one of the major mechanisms of gene evolution. The DNA chain breaks open and new links are added by one means or another. Some of the mechanisms are still pretty obscure.”

      “Is there any way to tell if humans played a part?”

      “Not absolutely. But sometimes there are telltale signs. Investigators often use restriction enzymes to open the DNA. You can spot them by the cut sites they leave behind - short DNA segments like the one used by Hind-III, A-A-G-C-T-T. Such sequences may remain in the DNA chain after it has been artificially altered. That seems not to be the case here, however.”

      He leaned forward, frowning at the sequence of code letters. “Hmm,” he murmured, deep in thought. “There is one peculiarity about the added sequence. It repeats itself.”

      “I saw that,” said Janet. “But I didn’t know what to make of it.”

      McKean drew a finger along the segment of inserted code, emphasizing it for my benefit. It read:

      GATATCGAGGATATCGAGGATATCGAG

      It was flanked on either side by additional letters with no more meaning for me than the segment he pointed out.

      “See how it repeats?” he asked. “Every nine letters, it repeats itself.”

      “No.” I shrugged. “It all looks random to me.”

      “Count it out, Fin. Read it in threes. G-A-T, A-T-C, G-A-G. See how that pattern repeats three times?”

      “Oh, yes!” I finally saw what had been plain to McKean’s experienced eye. “But I don’t get your point. So what if it repeats?”

      “Such repeats are extremely rare in nature, although they do happen. On the other hand, humans might do such a thing easily.”

      “Why?”

      “That is the big question, isn’t it?” McKean pondered the sequence a moment more, and then asked Janet, “Is this within the protein-coding segment of the gene?”

      “Yes it is.”

      “Then this insertion alters the B7R surface protein of the virus,” he said. “And that is consistent with the virus having avoided Fenton’s antibodies by having an altered surface covering. These changes may be the key to how that happened.”

      “How do DNA changes alter a protein?” I asked. “It’s been a while since I studied biology.”

      “Let me refresh your memory.” McKean took a professorial tone. “DNA code does nothing by itself. It is no more than a blueprint for other molecules to follow. The A, T, C and G code letters are read by other cellular molecules and translated into proteins that do the gene’s work. Proteins are also long strings of code letters, as you may recall.”

      “Yes,” I said. “Strings of amino acids.”

      “Very good,” said McKean. “There are twenty different kinds of amino acids that are strung together in making proteins. For simplicity, think of them like twenty different colors of beads in a child’s pop-it necklace. In your mind, undo that necklace so the string is linear, not circular. That’s the best model. Now, the amino acids of any protein are assembled into specific sequences according to the DNA code. To do that, the cell’s machinery reads the DNA letters three at a time and then translates them into the protein’s amino-acid code. But there is one more critical step. The protein does not remain just a long string of amino acids; it bunches up into a ball, the surface of which is covered with different amino acids - or beads, in my example - in a variety of patterns. Each of the many different types of proteins in your body jumbles up in a unique way and has a unique array of amino acids on its surface.”

      He entered a command into his computer’s keyboard. After a moment of number crunching, the screen blanked and then the DNA sequence reappeared, this time with a second line of code under the first. McKean pointed at the lower line.

      GATATCGAGGATATCGAGGATATCGAG

      AspIleGluAspIleGluAspIleGlu

      “See there,” he said, running his finger over the line. “The first three DNA letters, G-A-T, have been decoded into the amino acid, Asp, which is an abbreviation for aspartic acid, one of the building blocks of proteins. Next comes Ile, short for isoleucine, another amino acid; and then Glu, which stands for glutamic acid. Then those three amino acids repeat three times.”

      “Three repeats of three
    ,” I remarked. “I still don’t get the significance.”

      “I can’t help noting,” McKean remarked, “that two of the amino acids are unusual in being negatively charged - aspartic and glutamic acids.”

      “That’s important?”

      “Only in that the immune system is notable for the difficulty it has in dealing with highly negatively charged surfaces. This altered B7R protein has taken on a very strong negative charge, by virtue of this inserted sequence. That’s a pretty drastic alteration to the virus’s surface coat.”

      “An electrostatic charge,” Janet suggested, “to push the old antibodies away.”

      “Quite possibly,” said McKean. “This viral alteration is a diabolically clever way of evading immunity, no matter how it came about.”

      McKean was cool, but my pulse sped up. “Are you saying this virus is custom-made to cause disease?”

      “Answer: yes,” McKean murmured. And then he scowled more deeply at the screen. “Custom-made indeed.”

      I didn’t like a change I heard in his tone. “You weren’t sure if this mutation was natural or man-made,” I said. “Are you having second thoughts?”

      “More than that,” he replied quietly, staring at the computer as if he saw something profoundly disturbing. “I’m quite sure now. It is indeed man-made.”

      “What makes you so sure?” I was shaken by the implications of his calm statement.

      He typed in some new commands and made a quick half-explanation. “When in a hurry, molecular biologists use a shorthand to write amino-acid codes. They reduce each three-letter abbreviation to a single letter, sometimes having little connection to the original name. Asp, for instance, is shorthanded to D.”

      “Just D?” I asked.

      “Right. Using single-letter codes allows the twenty amino acids to be written quickly, using twenty different letters of the alphabet. Very efficient.”

      “But what’s your point?”

      The computer flashed the sequence in front of us again. A new third line had appeared:

      GATATCGAGGATATCGAGGATATCGAG

      AspIleGluAspIleGluAspIleGlu

      D I E D I E D I E

      Janet gasped. Momentarily at a loss, I scanned the sequence until the repeated message came clear.

      “DIE, DIE, DIE!” I exclaimed as the realization sank in that this was the product of an evil, all-too-human mind. “I can’t believe my eyes.”

      “Believe them,” McKean said grimly. “The probability that nature produced this sequence has just gone to zero.”

      McKean got on the phone to Kay Erwin while I sagged into a chair, astonished that our worst fear was now a reality. He explained the details to Kay, switching on his speakerphone so we could hear her response. “I just got off the phone with Fort Detrick,” she said. “General Moralez had the same news.”

      McKean glanced at me and tapped a fingertip to his temple. “Great minds run in the same gutter.”

      “You can’t think this is funny,” I complained.

      He shook his head, but seemed rather unperturbed by the confirmation of my worst fear. He clasped one elbow and tugged at his chin like some thoughtful Brahmin, as Kay replayed her conversation with the general.

      “They’re increasing Federal activity immediately. The President and the Secretary of Homeland Security are on this twenty-four, seven now. But they’re even more worried about panic, than before. I’ve been ordered to extract a promise of secrecy from my staff, and now I’ve got to ask the same of you and your people, Peyton. You too, Fin.”

      Peyton quickly said, “You can count on Janet and me.” Janet nodded.

      I acquiesced reluctantly. “This may cost me a news scoop.”

      Kay apologized, and then encouraged Peyton and Janet to increase their efforts. After goodbyes, McKean switched off the speakerphone. His office was suddenly, resoundingly silent. He scribbled a note on a yellow notepad, while my mind boggled at his calm air.

      “Peyton,” I began.

      “Hmm?” he responded, still scribbling.

      “I’m surprised your reaction is so matter-of-fact. Aren’t you scared?”

      He eyed me thoughtfully. “Answer: no. Although, I suppose I should be.” He glanced at Janet, who stood by his desk like a statue, her face as pale as marble and a tremor working through her thin body. Then he looked at me, and I’m sure I wasn’t much better off.

      “So,” he said curtly. “Two people in this room are having normal reactions to shocking news. That’s good enough. I’m busy.”

      He scribbled on his notepad some more while Janet and I exchanged blank looks.

      “Well,” I said. “If anyone needs to be cool and collected, I guess it ought to be the person most able to do something about it.”

      “And I’m that person,” said McKean.

      The phone rang and McKean hit the speakerphone button again. He said hello while continuing to write. A man’s voice said, “Hi, Peyton. It’s Cousin Mike, over here in Winthrop. I got a problem.”

      McKean leaned close to me and whispered for my benefit, “He owns some horse acreage in the Methow Valley, northeast of the Cascade Mountains.” He pronounced the word “Met-how.”

      “Who you whispering to?” asked Mike.

      “Two people,” McKean replied. “My head technician, Janet - “

      “Hi, Janet,” said Mike. “Remember me from your department’s camp-out last summer? That was my ranch you were on. My horses you folks rode. My cowshit you probably stepped in.”

      Janet shook herself slightly, mentally shifting gears. “Hi,” she said. “I remember you, Mike.”

      McKean continued the introductions. ” - and Fin Morton, a journalist.”

      “A reporter?”

      “Yes. A medical reporter.”

      “Good,” said Mike. “Maybe he can write about what’s going on over here.”

      “And what exactly is that?” McKean tapped his pencil on his notepad, eager to get back to his notes.

      “You know my neighbor that breeds Arabian horses? Calls his spread Arabians Unlimited?”

      “Yes,” said McKean, “I recall seeing his ranch gate on the highway.”

      “Well,” said Mike. “I found out he’s doin’ a lot more than raising Arabians. I wouldn’ta been suspicious but, well, the guy that owns the place - people call him the Sheik.”

      McKean raised an eyebrow as if pondering the same uncomfortable thought that immediately came to my mind. Mike went on, unaware of concerned glances the three of us exchanged. “He bought the ranch next to my place a couple years ago. Now, with all this talk about smallpox and terrorists, I just thought - “

      McKean frowned. “I don’t think you can suspect him of anything just because of his Arab origins. Since 9/11, too many people have been looking askance at perfectly good Arab-American citizens.”

      “No, you’re right,” said Mike. “There’s a Jordanian fellow on the volunteer fire department with me. He’s a good guy. I ain’t suspicious that way. Or, I wasn’t anyways. But there’s been a lotta people coming and going at Arabians Unlimited lately. A lotta cars. A lotta SUVs with dark-tinted windows. And some strange stuff happening.”

      “Such as?”

      “Well, I tend to a little weed patch up in the hills behind my house. I usually take my dog up there with me. Now, he’s got a mind of his own when he’s off leash. So yesterday I had to run him down way to-hell-and-gone across the next ridge. I got to where I could see my neighbors’ place. They got a big house and a couple of barns and some stables and stuff. And I saw something that didn’t sit too well. A black SUV pulls up and out get two men and they have a girl with them. A red-haired girl, and what gets me is it looks like they’ve got her hands cuffed behind her. They took her inside this one big building, like a poultry barn maybe, and, well, that’s all I know. I don’t think she wanted to go in there. They had to sort of pull her along.”

      “A red-haired girl!” I exclaimed, recalling the news report of the previous night. “One was kidnapped!”

      �
    �Damn straight,” said Mike.

      McKean asked, “Didn’t you call the police?”

      “Yeah, sure. I called the Sheriff’s Office when I got home. And Sheriff Barker stopped by later that day. Said he’d been over to check out the Sheik’s place, and I musta been seein’ things. He was real curious about where I was when I saw what I saw. Warned me not to trespass on my neighbor’s property. Said he’d talked to the Sheik and the Sheik was threatening to press charges if I came around there again. So it turns out I’m the one in trouble. Can you believe that?”

      “Um-hmm.” McKean murmured, wringing his lips thoughtfully.

      “But Sheriff Barker and me, we never did get along. He came to my place a couple years ago with a health inspector. Tried to condemn my well. Nearly ran me off my own property. Come to think of it, that was right after the Sheik moved in. I had to go to court and get permission to pump my own water. You know, Peyton, I really don’t like that it was right after the Sheik got here. You’d almost think the Sheriff was in cahoots with them or something. Maybe he’s on the take, you know what I mean?”

      “Perhaps,” said McKean. “But what is it you want me to do?”

      “I heard about that smallpox case on TV. They said ImCo was working on it, so I thought of you. I mean, suppose the people messing with smallpox are at the Sheik’s place? Ain’t you got some connections with the powers that be?”

      McKean looked dubious. “I suppose I might.”

      “Well maybe you could get them to look into this. I got a real strong feeling about it. It ain’t too far from here to the Sumas border crossing.”

      “I know that,” said McKean.

      “I guess I don’t have no proof. But what’s he doin’ with that woman? That’s what I wanna know.”

      “How far away were you when you saw the girl?”

      “Oh, ‘bout half a mile. Maybe a little closer.’

      McKean frowned. “Rather far away to be certain she was handcuffed. But it’s worth looking into. I’ll pass the word along.”

      “Thanks,” said Mike. “I gotta go now. Dog needs feedin’. Bye.”

      “Goodbye.” McKean clicked off the phone. “Mike’s got a Rottweiler,” he explained to me. “Between the dog and his shotgun, he’s probably quite safe from any foul play. But I wish I knew what to make of all this.”

     


    Prev Next
Online Read Free Novel Copyright 2016 - 2026