Online Read Free Novel
  • Home
  • Romance & Love
  • Fantasy
  • Science Fiction
  • Mystery & Detective
  • Thrillers & Crime
  • Actions & Adventure
  • History & Fiction
  • Horror
  • Western
  • Humor

    American Blood: A Vampire's Story

    Prev Next


      Ryan gave a wistful glance at the crates and walked over to his assistant. “How did the last set of plates come out?”

      “I just ran the image files through enhancement . . . let’s see what we have.”

      Ryan studied the large screen as the first image materialized. “Yep, it’s still there . . . a helix around a central helix. Nice work.”

      “As if there was any doubt,” Henry said. “I get paid the same even if it’s for redundancy.”

      “I’m going to start on the sequencing data from Calida’s cheek sample.”

      “Using her first name now?”

      “Yes, our subject, Calida,” Ryan continued. “With these two HeliScope Gene Sequencers and the Cray XT5s performing confirmation downstream, I should be able to make some serious progress before nightfall.”

      “Sounds like a plan . . . I still can’t believe we’ve been given this equipment,” Henry said. “This setup must have cost a truck load of cash.”

      Ryan smiled and shrugged. The HeliScope Sequencers ran over a million and a half dollars each and just one could map an entire human genome in a single day. What took months to achieve five years ago could be accomplished in hours.

      “Well into seven figures,” Ryan admitted. “As soon as we’re done I’m sure it will all be whisked away for some other project. Let’s enjoy it while we have it. I’ve been told we get to keep the Crays.”

      “Let’s keep the whole setup,” Henry said.

      “Has anyone ever told you that you’re too needy?”

      “Because you’re not thinking the same thing.”

      Ryan laughed. “Oh, I’m thinking it.”

      “I have another set of standards to calibrate and when I’m done I’ll prep the sequence loaders for the next round. I can’t wait to see if her coding lines up with anything in the genome database at the NIH.”

      “Don’t hold your breath,” Ryan said. “I suspect she has her own unique set of genes determining her body plan, but with her ability to change appearance, there must be something radically different with them.”

      “I bet Darwin is rolling in his grave,” Henry said.

      “Maybe,” Ryan replied. “At the very least he’s smiling.”

      “Why do you say that?”

      “Because he doesn’t have to figure out this impossible mess.”

      “Point taken.”

      Ryan walked over to his main workstation and reviewed the gene sequencing results on the first set of samples obtained from Calida. The sequencer could run multiple samples in parallel that greatly increased their throughput. Yet the most extraordinary ability of these systems was that they could perform sequencing using a single DNA molecule. They didn’t require the polymerase chain reaction method that produced millions of copies from a DNA source which were then used to obtain sequencing data. The PCR method was prone to errors and was far more likely to produce copies of any contaminant DNA that could interfere with the final results.

      Ryan had targeted a specific region of Calida’s DNA with the initial samples and directed the analysis software to compare the samples with each other. All three samples should have the same order of the four nucleotide bases: adenine, thymine, guanine, and cytosine, which were the absolute carriers of DNA’s genetic information. Ryan intensely studied the results of the first thirty-two bases for the three samples:

      Blood_01CA: ACGGTTGCGGTATCCGTGACGGGAACCGATAC . . . Blood_02CA: ACCTGCTAGCTCCCTAATAACCTATCCGGTCA . . . Blood_03CA: CCTCGCGAATCGATCGAATAATCGCTAATGCT . . . Ryan frowned. He scrutinized the identifications that were entered for the three samples. All three were direct blood draws from Calida. They had been taken within hours of each other before she was immersed in the sphere on day one of her captivity. Henry had minimized the risk of any contamination by taking the DNA directly from the large fraction of nucleated white blood cells in her blood.

      Ryan looked up from the screen. “Have you noticed anything odd about these initial samples in terms of their base sequences?”

      “Yeah, they don’t match,” Henry replied.

      “It’s her blood taken three times over three hours and the base sequences give different results all three times?” Ryan looked at the screen again. “It’s as if her DNA wasn’t stable from one minute to the next. It keeps re-sequencing itself.”

      “And the standards ran normal,” Henry said. “Since DNA is a template for directing everything that goes on inside her cells, how can it be used if it’s never the same?”

      “Let’s look at the initial sequencing on her cheek sample. And how about a prayer?” Ryan minimized the result window that he had been looking at and navigated through a series of drop down menus until he arrived at the result file for the epithelial cell sample he had sequenced. He selected that result, restored the data window he had originally been looking at, and copied this fourth sequence into the window so that he could compare the original three blood samples with the epithelial cells.

      “Have you looked at this?” he asked Henry.

      “No, I didn’t want to spoil your fun.”

      “There’s no agreement,” Ryan said. “DNA from her blood not only doesn’t agree with itself, it doesn’t match up with her tissue samples either. The only thing this latest and greatest equipment has done for me is make me crazy faster, I guess.”

      “Is that all you have right now?”

      Ryan leaned back in his chair and sighed. “Maybe Satan is tinkering with her DNA after all,” he replied. “And he’s got a nasty sense of humor . . . I mean what is she?”

      “Whatever she is,” Henry said and turned his attention back to his workstation. “Vampire, alien, or the boogey-women, she’s not one of us.”

      Ryan took a few measured breaths and began inputting commands into his workstation. He created a file with all of Calida’s samples processed so far lined up in rows for comparison and started a sequence editing program that he had written. He set the variables to look for any commonality between the different samples starting at ten consecutive base pairs and increasing the search at the completion of each pass by a factor of ten up to the final search of one billion consecutive base pairs. He then, just out of curiosity, setup another search on the second Cray to look across the different samples for any commonality. Gene sequences were a linear ordering of bases along the length of the DNA molecule, but this second search would look for order in a second time-based dimension.

      While the Cray performed its silent number crunching, Ryan brought his research journal up to date and after he completed that mundane task he got up and joined Henry who was mumbling about something on his display screen. Because Calida had the fantastic ability to change her appearance, similar to certain species of undersea squid and cuttlefish, Ryan had directed Henry to prepare samples of Calida’s skin and have them prepped for electron scanning microscopy by plating them with gold, which was standard procedure. Ryan stood silently behind Henry and as an electron micrograph flashed on the screen they both gasped.

      “What are those?” Ryan looked at the sample label on the image.

      “I don’t know, but it’s from her skin,” Henry said, stating the obvious.

      “What other skin samples have you scanned?”

      “Uh, hold on . . . that was the first one, and it’s from her face. The next one will be her neck, then her left arm . . . stomach . . . left thigh . . . and, uh, her right foot. These were from that set of skin samples that were obtained when she arrived. I prepared the samples last night and finished plating them before I went home. This was my first chance to take a look.”

      “They look like cylinders,” Ryan said. “At this resolution they would be maybe twenty nanometers in diameter by one hundred long. Okay, they’re about the size of a virus. Back the magnification up. More . . . more . . . that’s it!”

      “There has to be hundreds of them in the field at this mag,” Henry said.

      “And that means there are millions per square inch of her skin. Go maximum resolution on one of them,” Ryan instructed.


      “Here’s a nice one . . . uh . . . there, that’s as high as the machine goes,” Henry said. “Yep, it’s a cylinder, and appears solid.”

      “Yeah, and it has a slight taper from the base to the other end,” Ryan said. “But look down at the base where it attaches to the underlying cell . . . if that’s not the base plate of a bacteriophage. This thing looks like a mutated virus.”

      Henry again reduced the magnification. “See? All of them are attached to a companion cell with that same base plate.”

      “And these fine filaments that come out of the cells . . . .” Ryan took his pen and followed the path of one of the filaments. “See how it just runs into the next closest companion cell? I think that all of these cylinders are wired together by these cells.”

      “Wired to do what?” Henry asked.

      “I wish I knew. These cells appear to be neural in nature. At first glance they appear to be neurons from brain tissue. I can only guess that we’re looking at some kind of evolved network that is as much a part of her skin as our system of sweat glands. Maybe it’s related to her ability to change appearance.”

      “Look, most of the cylinders are oriented so that they are standing straight up,” Henry said. “Almost all of them have the smaller end pointing outward.”

      Ryan nodded. “Change of plans. I want you to take a frozen skin sample and see if you can separate some of these cylinders. I want to see what they’re made of. I’d guess protein and probably be wrong. Maybe you can do a scraping with the microtome under high magnification and see if some will rub off.”

      “Okay, if I can get some isolated I’ll run them through the mass spectrometer so we’ll have a baseline of what elements are present and work up from there.”

      Ryan checked the time. Six hours had flashed by.

      “I’m going to see how the Cray is doing with my sequencing program and after that I’ll prep the next round of samples for the HeliScopes. It’s time I started getting my hands dirty.”

      “Amen.”

      Ryan immersed himself in the task of preparing another set of samples from Calida’s blood and tissues for gene sequencing. The HeliScope systems consisted of a sample loader about the size of a desk top printer that prepared samples for the sequencing run. The prepared samples from the loader were then delivered to the molecular sequencer itself that looked like a small refrigerator. The raw data generated by the molecular sequencer then fed into the data analysis engine, a super computer in its own right, with one pentaflop performance and one hundred twenty-eight terabytes of storage capacity.

      The entire system was run by a central control center that monitored the sequencing runs and maintained the environmental variables for the other units. The system resembled two refrigerators standing next to each other. And Ryan had two complete systems sitting in front of him.

      Even with all of this computing power under his control Ryan felt ill equipped to solve the complex riddles of Calida’s molecular structure. Never before had the burden of scientific research felt so heavy on his shoulders.

      Chapter Eight

      “Justice is the constant and perpetual will to allot to every man his due.”

      —Domitus Ulpian, Roman Juror

      At 5:57 PM Ryan received an urgent call from Siri.

      “. . . I don’t understand . . . the barrier is down in her cell?” he asked. “Did she knock it over?”

      Ryan listened for a moment. “What? Okay, I’m coming now.” Ryan turned the speaker off and jumped up from his workstation. “Henry, I’m going over to the medical building. Something has happened.”

      Henry was at one of the lab’s vent hoods using formaldehyde to fixate some new tissue samples. He couldn’t turn away from his work. “I’ll be here for another hour. Email me on what happened if I don’t see you until tomorrow, okay?” But Ryan didn’t reply since he had already left the lab.

      Ryan rushed out of the molecular science building and into a depressing drizzle. By the time he reached the medical clinic he was breathing hard. It didn’t take long to get to the air lock inside the isolation unit. As soon as the air cycled he hurried out and made a direct line to Calida’s cell on the left. He walked through the open door.

      “Well that didn’t take long,” Siri said.

      Ryan came to a hard, awkward stop.

      “It’s fine,” Siri said. “Everything is fine, okay?”

      “Where’s the plexiglas?”

      “It was taken down a few hours ago.”

      “And what about her?” Ryan looked at Calida sitting on her cot. He studied her for a moment and noticed that her nose was off center somehow. She also had dried blood on her lips and spots on her patient gown.

      “She’s not going to harm us,” Siri said. “You can come all the way in now.”

      “What’s going on?”

      “She won’t discuss it.”

      Ryan hesitated. “What happened to you?” he asked, but Calida refused to make eye contact with him.

      “The Director has made an arrangement with her from what I understand,” Siri said.

      “What happened to your nose?” Ryan asked, but Calida still remained silent. “So you’re not going to talk to me?”

      “I had a little accident and broke it earlier,” Calida stiffly replied, but she still didn’t look directly at Ryan. “Don’t worry, it’ll heal soon enough. It always does.”

      Ryan waited for a moment. “And that’s it? You’re not going to tell me anything else?”

      “You’re out of breath,” Calida observed. “Did you run here or are you worried that I might try to hurt you?”

      “I’m not worried,” he replied. “There’s nothing I could do to stop you anyway, right?”

      Calida gave him a strange look but didn’t answer.

      Siri removed clothes from several large shopping bags next to Calida’s cot. Ryan finally settled down enough to look around and discovered that a partition had been placed along the wall behind the cot. A small dresser sat next to the partition which made everything even more surreal.

      “Here you go,” Siri said and walked over to the cot laying the clothes she had picked down. “Take these and go behind there for some privacy and change out of that bloody thing.”

      Calida glanced over at the clothes but remained sitting.

      “Okay . . . you can put them on when you’re ready,” Siri said and sat down on one of the available chairs.

      Ryan gave Siri a helpless shrug, evened his breathing, and walked over to the cot and picked up the clothes. “Here, take these and get dressed,” he said. “Then we can talk if you want.”

      Calida met Ryan’s eyes then looked back at the clothes. “All right,” she said. “Why not?” She grabbed the clothes, stood up right next to Ryan who instinctively flinched at their sudden proximity, walked around the cot and went behind the partition.

      Ryan wondered if a deaf person would be able to hear his heart pounding as he walked over to one of the other chairs, picked it up, and placed it next to Siri. He slowly composed himself and sat down. “When did this all go down?”

      “It must have happened while she was sleeping,” Siri replied. “The Director briefed me this morning after our talk at your apartment. I don’t know how he was able to arrange this with her, but here we are.”

      “I don’t trust that man.” Ryan deliberately looked up at one of the video cameras for a silent minute. He then leaned toward Siri and in a soft voice said: “She just seems so subdued.”

      “Let me tell you about my hearing,” Calida said, and she stepped from behind the partition.

      “Sorry.”

      Calida had put on a pair of jeans and a green blouse which complimented her dark reddish brown hair. She had cleaned herself up and her nose had nearly straightened itself back to normal. She stepped right up to Siri and gave her the patient gown she had been wearing.

      “Now what?” Calida asked.

      “Can we talk some more?” Siri replied, and she folded the bloodied disposable gown and placed it on
    her lap.

      Calida went over to the chair next to the feeding apparatus and sat down. “Ask your questions,” she said. “But I’ll be hungry soon.” And she stared at Ryan.

      Siri opened her notebook and paged through it. She appeared to gather her thoughts for a moment and then looked up at Calida. “Do you know how you became a vampire?”

      “How do you think it happened?”

      “I know you weren’t bitten.”

      “No.”

      “It appears to be the result of an infection.”

      “You believe I’m a vampire because I caught a cold?”

      “Not really just a cold,” Siri replied. “It happened, we believe, because you were a leper.”

      “It’s because I changed that I no longer worry my skin will rot away.” Calida’s voice became anxious. “That disease made me ugly, nothing more.”

      “The evidence points to an infection of some kind. Do you remember when you first became sick and were sent to those caves with the others?”

      Calida intently looked at Siri for a moment.

      Ryan became apprehensive. “Maybe this isn’t a good time and we should wait until after you’ve fed.”

      “May I have a moment to remember?” Calida directed at Ryan. “I’m not like one of your computers. Nineteen hundred years is a long way back.”

      “Do you remember anything?” Siri asked.

      Calida closed her eyes. The only sound was air moving through the ceiling vents. Ryan felt a growing anticipation as they waited for Calida to search her ancient memories, but there was also an unyielding sense of dread.

      “I remember my face . . . that my face had the disease,” she finally replied. “I remember my parents tried to hide me. Soon after they came and took me away.”

      “Who took you away?” Siri asked

      “The Romans.”

      “I’m sorry,” Ryan said.

      “The diseased could only be with their own,” Calida said. “There was no other way.”

      “We can cure leprosy today,” Siri said. “Back then, before man understood disease, fear was the only cure. That’s why you and the others were banished to these caves.”

     


    Prev Next
Online Read Free Novel Copyright 2016 - 2026