Piqued, Huxley makes his excuses and walks off.
The following day. The doors to the great hall are thrown open. The place is packed but only one voice is heard. We pan in for a tight close-up of the Bishop of Oxford, Samuel Wilberforce (George Arliss). Fingers in lapels, he turns pointedly to Huxley (who is of course there, despite his protestations of scheduling conflicts) and with arch courtesy begs to know “whether it is through your grandfather or your grandmother that you claim your descent from a monkey?” Grasping the smarmy nuance of “grandmother,” the crowd utters low “ooh’s” and turns its attention to Huxley.
Still seated, Huxley turns to the man next to him and, almost winking, murmurs, “The Lord hath delivered him into mine hands.” Rising and looking Wilberforce squarely in the eye, he says: “I would rather be the offspring of two apes than be a man and afraid to face the truth.”
The crowd has never seen a bishop insulted to his face before. Stunned reaction. Ladies faint. Men shake their fists. Chambers in the crowd, positively gleeful. But wait. There’s someone else standing up. Why, it’s Vice-Admiral Robert FitzRoy (Ronald Reagan), back in England after his term as Governor of New Zealand. “I was arguing with Charles Darwin and his crazy ideas thirty years ago on the Beagle.” And then, brandishing his Bible: “This and this alone is the source of all truth.” More clamor.
Now it’s Hookers turn (Henry Fonda). Sincerely, “I knew this theory fifteen years ago. I was then entirely opposed to it; I argued against it again and again; but since then I have devoted myself unremittingly to natural history; in its pursuit I have traveled around the world. Facts in this science which before were inexplicable to me became one by one explained by this theory, and conviction has been thus gradually forced upon an unwilling convert.”
The camera pulls out of the great hall. Dissolve to a close-up of a finch perched on the branch of a tree. A bearded man (Ronald Colman), kindly, dressed in rural gentleman’s hat and cape, but with a muffler despite the June weather, is staring lovingly up at the bird. He hardly seems to hear the voice of his wife (Billie Burke), high-pitched, affectionate, calling from the great house, off-camera: “Charles … CHARLES … Trevor is here with news from that meeting at Oxford.” He casts one appreciative look back at the finch before finally walking off to the house …28
* “[G]irls have been educated either to be drudges or toys, beneath men; or a sort of angels above him The possibility that women are meant to be men’s comrades, their fellows, and their equals, so far as Nature puts no bar on that equality, does not seem to have entered into the minds of those who have had the conduct of the education of girls.” The first step to a better world, he said, was “Emancipate girls” Their hair “will not curl less gracefully outside the head by reason of there being brains within”29
Chapter 5
LIFE IS JUST A THREE-LETTER WORD
Who first drives life to begin its journey?
The Kena Upanishad
(8th to 7th centuries B.C., India)1
Who’s aware of mutability?
Not even Buddhas.
DAITETSU
(1333–1408, Japan)2
In a shaft of sunlight, even when the air is still, you can sometimes see a tribe of dust motes dancing. They move in zigzag paths as if animated, motivated, propelled by some small but earnest purpose. Some of the followers of Pythagoras, the ancient Greek philosopher, thought that each mote had its own immaterial soul that told it what to do, just as they thought that each human has a soul that gives us direction and tells us what to do. Indeed, the Latin word for soul is anima—it is something similar in many modern languages—from which come such English words as “animate” and “animal.”
In fact, those motes of dust make no decisions, have no volition. They are instead the passive agents of invisible forces. They’re so tiny that they’re battered about by the random motion of molecules of air, which have a slight preponderance of collisions first on one side of the mote and then on the other, propelling them, with what looks to us as some mix of intention and indecision, through the air. Heavier objects—threads, say, or feathers—cannot much be jostled by molecular collisions; if not wafted by a current of air, they simply fall.
The Pythagoreans deceived themselves. They did not understand how matter works on the level of the very small, and so—from a specious and oversimple argument—they deduced a ghostly spirit that pulls the strings. When we look around us at the living world, we see a profusion of plants and animals, all seemingly designed for specific ends and single-mindedly devoted to their own and their offspring’s survival—intricate adaptations, an exquisite match of form to function. It is natural to assume that some immaterial force, something like the soul of a dust mote, but far grander, is responsible for the beauty, elegance, and variety of life on Earth, and that each organism is propelled by its own, appropriately configured, spirit. Many cultures all over the world have drawn just such a conclusion. But might we here, as did the ancient Pythagoreans, be overlooking what actually goes on in the world of the very small?
We can believe in animal or human souls without holding to evolution, and vice versa. But if we examined life more closely, might we be able to understand at least a little of how it works and how it came to be, purely in terms of its constituent atoms? Is something “immaterial” present? If so, is it in every beast and vegetable, or just in humans? Or is life no more than a subtle consequence of physics and chemistry?
——
One educated look at how the molecule is shaped and you can figure out what it’s for. Even at the molecular level, function follows form. Before us is a detailed blueprint of breathtaking precision for building complex molecular machines. The molecule is very long and composed of two intertwined strands. Running the length of each strand is a sequence made of four smaller molecular building blocks, the nucleotides—which humans conventionally represent by the letters A, C, G, and T. (Each nucleotide molecule actually looks like a ring, or two connected rings, made of atoms.) On and on the sequence goes, for billions of letters. A short segment of it might read something like this:
ATGAAGTCGATCCTAGATGGCCTTGCAGACACCACCTTCCGTACCATCACCACAGACCTCCT …
Along the opposite strand there’s an identical sequence, except that wherever nucleotide A was in the first strand, it’s T in the second; and instead of G it’s always C. And vice versa. Like this:
TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAGGA …
This is a code, a long sequence of words written out in an alphabet of only four letters. As in ancient human writing, there are no spaces between the words. Inside this molecule there are, written in a special language of life, detailed instructions—or rather, two copies of the same detailed instructions, because the information in one strand can surely be reconstructed from the information in the other, once you understand the simple substitution cipher. The message is redundant, bespeaking care, conservatism; it conveys a sense that whatever it is saying must be preserved, treasured, passed intact to future generations.
Almost every issue of leading scientific journals such as Science or Nature contains the newly uncovered ACGT sequence of some part of the genetic instructions of some lifeform or other. We’re slowly beginning to read the genetic libraries. The library of our own hereditary information, the human genome, is also becoming increasingly revealed, but there’s a lot to read: Every cell of your body has a full set of instructions about how to manufacture you, encoded in a very compressed format—it takes only a picogram (a trillionth of a gram) of this molecule to specify everything you’ve inherited from your ancestors, back to the first beings of the primeval sea. Yet, there are
almost as many nucleotide building blocks, or “letters,” in the microminiaturized genetic information in any of your cells as there are people on Earth.
All words in the genetic code are three letters long. So, if we insert the implicit spaces between the words, the beginning of the first message above looks like this:
ATG AAG TCG ATC CTA GAT GGC CTT GCA GAC ACC ACC TTC CGT ACC …
Since there are only four kinds of nucleotides (A, C, G, and T), there are at most only 4 × 4 × 4 = 64 possible words in this language. But if the order in which the words are put together is central to the meaning of the message, you can say a great deal with only a few dozen different words. With messages that are a billion carefully selected words long, what might be possible? You must take care in reading the message, though: With no spaces between the words, if you start reading at the wrong place, the meaning will surely change and a lucid message might be reduced to gibberish. This is one reason the giant molecule has special code words meaning “START READING HERE” and “STOP READING HERE.”
As you watch the molecule closely you observe that the two strands occasionally unwind and unzip. Each copies the other, using available A, C, G, and T raw materials—like the metal type stored in an old-fashioned printer’s box Now, instead of one pair, there are two pairs of identical messages. As well as utilizing a language and embodying a complex, redundantly encoded text, this molecule is a printing press.
But what’s the use of a message if nobody reads it? Through copying links and relays, the sequences of As, Cs, Gs, and Ts are revealed to be the job orders and blueprints for the construction of particular molecular machine tools. Some sequences are orders to itself—arranging for the giant molecule to twist and kink so it can then issue a particular set of instructions. Other sequences ensure that the instructions will be followed to the letter. Many three-letter words specify a particular amino acid (or a punctuation mark, like the one that signifies “START”) out there in the surrounding cell, and the sequence of words encoded determines the sequence of amino acids that will make up the protein machine tools that control the life of the cell. Once such a protein is manufactured, it usually twists and folds itself into a three-dimensional shape spring-loaded for action. Sometimes another protein bends it into shape. These machine tools, at a pace determined both by the long double-stranded molecule and by the outside world, then proceed on their own to strip other molecules down, to build new ones up, to help communicate molecular or electrical messages to other cells.
This is a description of some of the humdrum, everyday action in each of the ten trillion or so cells of your body, and those of nearly every other plant, animal, and microbe on Earth. The tiny machine tools perform stupefying feats of molecular transformation. They are submicroscopic and made of organic molecules, rather than macroscopic and made of silicates or steel, but at the molecular level life was tool-using and tool-making from the start.
The long self-replicating double-stranded molecule with the complex message is a sequence of genes, a little like beads on a string. Chemically, it is a nucleic acid (here, the kind abbreviated DNA, which stands for deoxyribonucleic acid). The two strands, wrapped around each other, comprise the famous DNA double helix. The nucleotide bases in DNA are called adenine, cytosine, guanine, and thymine, which is where the abbreviations A, C, G, and T come from. Their names date back to long before their key role in heredity was understood. Guanine, for example, is named unpretentiously after guano, the bird droppings from which it was first isolated. It is a double ring molecule made of five carbon atoms, five hydrogens, five nitrogens, and one oxygen. There’s something like a billion guanines (and roughly equal numbers of As, Cs, and Ts) in the genes of any one of your cells.
Except for some oddball microbes, the genetic information of every organism on Earth is contained in DNA—a molecular engineer of formidable, even awesome talents. One (very long) sequence of As, Cs, Gs, and Ts contains all the information for making a person; another such sequence, nearly identical, for a chimpanzee; others, not so different, for a wolf or a mouse. In turn, the sequences for nightingales, sidewinders, toads, carp, scallops, forsythia, club mosses, seaweed, and bacteria are still more different—although even they collectively hold many sequences of As, Cs, Gs, and Ts in common. A typical gene, controlling or contributing to one specific hereditary trait, might be a few thousand nucleotides long. Some genes may comprise more than a million As, Cs, Gs, and Ts. Their sequences specify the chemical instructions for, say, manufacturing the organic pigments that make eyes brown or green; or extracting energy out of food; or finding the opposite sex.
How this complex information got into our cells, and how arrangements were made for its precise replication and the obedient implementation of its instructions, is tantamount to asking how life evolved. Nucleic acids were unknown when The Origin of Species was first published, and the messages they contain were not to be deciphered for another century. They constitute the demonstration and definitive record of evolution that Darwin sought. Scattered in the ACGT sequences of the diverse lifeforms of our planet is an incomplete history of the evolution of life—not the blood, bones, brains, and the other manufactured products of the genetic factories, but the actual production records, the master instructions themselves, slowly varying at different rates in different beings in different epochs.
Because evolution is conservative and reluctant to tamper with instructions that work, the DNA code incorporates documents—job orders and blueprints—dating back to remote biological antiquity. Many passages have faded. In some places there are palimpsests, where remains of ancient messages can be seen peeking out from under newer ones. Here and there a sequence can be found that is transposed from a different part of the message, taking on a different shade of meaning in its new surrounds; words, paragraphs, pages, whole volumes have been moved and reshuffled. Contexts have changed. The common sequences have been inherited from remote times. The more distinct the corresponding sequences are in two different organisms, the more distantly related they must be.
These are not only the surviving annals of the history of life, but also handbooks of the mechanisms of evolutionary change. The field of molecular evolution—only a few decades old—permits us to decode the record at the heart of life on Earth. Pedigrees are written in these sequences, carrying us back not a few generations, but most of the way to the origin of life. Molecular biologists have learned to read them and to calibrate the profound kinship of all life on Earth.5 The recesses of the nucleic acids are thick with ancestral shadows.
We can now almost follow the itinerary of the naturalist Loren Eiseley:
Go down the dark stairway out of which the race has ascended. Find yourself at last on the bottommost steps of time, slipping, sliding, and wallowing by scale and fin down into the muck and ooze out of which you arose. Pass by grunts and voiceless hissings below the last tree ferns. Eyeless and earless, float in the primal waters, sense sunlight you cannot see and stretch absorbing tentacles toward vague tastes that float in water.6
A particular sequence of As, Cs, Gs, and Ts is in charge of making fibrinogen, central to the clotting of human blood. Lampreys look something like eels (although they are far more distant relations of ours than eels are); blood circulates in their veins too; and their genes also contain instructions for the manufacture of the protein fibrinogen. Lampreys and people had their last common ancestor about 450 million years ago. Nevertheless, most of the instructions for making human fibrinogen and for making lamprey fibrinogen are identical. Life doesn’t much fix what isn’t broken. Some of the differences that do exist are in charge of making parts of the molecular machine tools that hardly matter—something like the handles on two drill presses being made of different materials with different brand names, while the guts of the two are identical.
Or here, to take another example, are three versions of the same message,7 taken from the same part of the DNA of a moth, a fruit fly, and a crustacean:
Moth:
GTC GGG CGC GGT CAG TAC TTG GAT GGG TGA CCA CCT GGG AAC ACC GCG TGC CGT TGG …
Fruit fly:
GTC GGG CGC GGT TAG TAC TTA GAT GGG GGA CCG CTT GGG AAC ACC GCG TGT TGT TGG …
Crustacean:
GTC GGG CCC GGT CAG TAC TTG GAT GGG TGA CCG CCT GGG AAC ACC GGG TGC TGT TGG …
Compare these sequences and recall how different a moth is from a lobster. But these are not the job orders for mandibles or feet—which could hardly be closely similar in moths and lobsters. These DNA sequences specify the construction of the molecular jigs on which newly forming molecules are laid out under the ministrations of the molecular machine tools. Down at this level, it’s not absurd that moths and lobsters might have closer affinities than moths and fruit flies. The comparison of moth and lobster suggests how slow to change, how conservative the genetic instructions can be. It’s a long time ago that the last common ancestor of moths and lobsters scudded across the floor of the primeval abyss.
We know what every one of those three-letter ACGT words means—not just which amino acids they code for, but also the grammatical and lexigraphical conventions employed by life on Earth. We have learned to read the instructions for making ourselves—and everybody else on Earth. Take another look at “START” and “STOP.” In organisms other than bacteria, there’s a particular set of nucleotides that determine when DNA should start making molecular machine tools, which machine tool instructions should be transcribed, and how fast the transcription should go. Such regulatory sequences are called “promoters” and “enhancers.” The particular sequence TATA, for example, occurs just before the place where transcription is to occur. Other promoters are CAAT and GGGCGG. Still other sequences tell the cell where to stop transcribing.8